Review




Structured Review

Biotechnology Information coding sequence cds region
Coding Sequence Cds Region, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/10__1016_slash_j__stress__2025__100887-98-1-16?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
coding sequence cds region - by Bioz Stars, 2026-08
86/100 stars

Images



Similar Products

99
New England Biolabs coding region sequence cds
Coding Region Sequence Cds, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pm41643674-823-1-15?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
coding region sequence cds - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Synbio Technologies LLC small interfering rnas targeting the thap11 gene coding sequence (cds) region
Small Interfering Rnas Targeting The Thap11 Gene Coding Sequence (Cds) Region, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pm40548980-82-1-18?v=Synbio+Technologies+LLC
Average 90 stars, based on 1 article reviews
small interfering rnas targeting the thap11 gene coding sequence (cds) region - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Biotechnology Information coding sequence cds region
Coding Sequence Cds Region, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/10__1016_slash_j__stress__2025__100887-98-1-16?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
coding sequence cds region - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Biotechnology Information coding sequence (cds) region of the goat slam gene
Coding Sequence (Cds) Region Of The Goat Slam Gene, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pm40103005-50-7-17?v=Biotechnology+Information
Average 90 stars, based on 1 article reviews
coding sequence (cds) region of the goat slam gene - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

94
Addgene inc coding sequence cds region
Coding Sequence Cds Region, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pm39693003-48-22-40?v=Addgene+inc
Average 94 stars, based on 1 article reviews
coding sequence cds region - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Proteintech fbxl5 coding sequence cds region
A)ALKBH5 upregulated <t>FBXL5</t> expression by m 6 A demethylation. We performed m 6 A sequencing in A549 cells and identified m 6 A peaks across different regions in negative control (EV) and ALKBH5 overexpressed (ALKBH5 OE) cells; B) Volcano plot displayed significant m 6 A methylation peaks that were upregulated and downregulated by ALKBH5; C) We observed decreased m 6 A methylation (m 6 A demethylation) in the genomic CDS region; D) Cumulative percent and E) quantified changes for methylation indicated overall decreased methylation by ALKBH5 overexpression; F) Specific decreased m 6 A peak of the CDS region in FBXL5 mRNA in the presence of ALKBH5 overexpression in A549 cells; G) IHC staining of NSCLC tissue microarray indicated a positive correlation between ALKBH5 and FBXL5 protein expression; H) Western blot revealed upregulated FBXL5 by ALKBH5 overexpression in A549 and H226 NSCLC cells; I) Graphical interpretation of FBXL5 and ALKBH5 mutations stably transfected into NSCLC cells; J) m 6 A‐RIP‐qPCR demonstrated m 6 A methylation in FBXL5 mRNA; K) Common RIP‐qPCR demonstrated binding of ALKBH5 to FBXL5 mRNA. Western blot was presented for quality control in protein extracted from the input group and the groups immunoprecipitated by IgG and ALKBH5 antibody; L) ALKBH5 H204A mutation impaired the binding of ALKBH5 to FBXL5 mRNA as indicated by RIP‐qPCR. Western blot was performed for quality control using protein extracted from the corresponding groups; M) Western blot in NSCLC cells indicated that wild‐type ALKBH5 could upregulate wild‐type FBXL5, but this regulation was attenuated in the presence of ALKBH5 H204A mutation or FBLX5 synonymous mutation in potentially m 6 A sites.
Fbxl5 Coding Sequence Cds Region, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pmc11791940-224-23-38?v=Proteintech
Average 96 stars, based on 1 article reviews
fbxl5 coding sequence cds region - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Twist Bioscience custom probe panel of 50 genes targeting exons in the coding sequence (cds) region
A)ALKBH5 upregulated <t>FBXL5</t> expression by m 6 A demethylation. We performed m 6 A sequencing in A549 cells and identified m 6 A peaks across different regions in negative control (EV) and ALKBH5 overexpressed (ALKBH5 OE) cells; B) Volcano plot displayed significant m 6 A methylation peaks that were upregulated and downregulated by ALKBH5; C) We observed decreased m 6 A methylation (m 6 A demethylation) in the genomic CDS region; D) Cumulative percent and E) quantified changes for methylation indicated overall decreased methylation by ALKBH5 overexpression; F) Specific decreased m 6 A peak of the CDS region in FBXL5 mRNA in the presence of ALKBH5 overexpression in A549 cells; G) IHC staining of NSCLC tissue microarray indicated a positive correlation between ALKBH5 and FBXL5 protein expression; H) Western blot revealed upregulated FBXL5 by ALKBH5 overexpression in A549 and H226 NSCLC cells; I) Graphical interpretation of FBXL5 and ALKBH5 mutations stably transfected into NSCLC cells; J) m 6 A‐RIP‐qPCR demonstrated m 6 A methylation in FBXL5 mRNA; K) Common RIP‐qPCR demonstrated binding of ALKBH5 to FBXL5 mRNA. Western blot was presented for quality control in protein extracted from the input group and the groups immunoprecipitated by IgG and ALKBH5 antibody; L) ALKBH5 H204A mutation impaired the binding of ALKBH5 to FBXL5 mRNA as indicated by RIP‐qPCR. Western blot was performed for quality control using protein extracted from the corresponding groups; M) Western blot in NSCLC cells indicated that wild‐type ALKBH5 could upregulate wild‐type FBXL5, but this regulation was attenuated in the presence of ALKBH5 H204A mutation or FBLX5 synonymous mutation in potentially m 6 A sites.
Custom Probe Panel Of 50 Genes Targeting Exons In The Coding Sequence (Cds) Region, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pmc11693435-55-15-22?v=Twist+Bioscience
Average 90 stars, based on 1 article reviews
custom probe panel of 50 genes targeting exons in the coding sequence (cds) region - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Genechem lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga)
A)ALKBH5 upregulated <t>FBXL5</t> expression by m 6 A demethylation. We performed m 6 A sequencing in A549 cells and identified m 6 A peaks across different regions in negative control (EV) and ALKBH5 overexpressed (ALKBH5 OE) cells; B) Volcano plot displayed significant m 6 A methylation peaks that were upregulated and downregulated by ALKBH5; C) We observed decreased m 6 A methylation (m 6 A demethylation) in the genomic CDS region; D) Cumulative percent and E) quantified changes for methylation indicated overall decreased methylation by ALKBH5 overexpression; F) Specific decreased m 6 A peak of the CDS region in FBXL5 mRNA in the presence of ALKBH5 overexpression in A549 cells; G) IHC staining of NSCLC tissue microarray indicated a positive correlation between ALKBH5 and FBXL5 protein expression; H) Western blot revealed upregulated FBXL5 by ALKBH5 overexpression in A549 and H226 NSCLC cells; I) Graphical interpretation of FBXL5 and ALKBH5 mutations stably transfected into NSCLC cells; J) m 6 A‐RIP‐qPCR demonstrated m 6 A methylation in FBXL5 mRNA; K) Common RIP‐qPCR demonstrated binding of ALKBH5 to FBXL5 mRNA. Western blot was presented for quality control in protein extracted from the input group and the groups immunoprecipitated by IgG and ALKBH5 antibody; L) ALKBH5 H204A mutation impaired the binding of ALKBH5 to FBXL5 mRNA as indicated by RIP‐qPCR. Western blot was performed for quality control using protein extracted from the corresponding groups; M) Western blot in NSCLC cells indicated that wild‐type ALKBH5 could upregulate wild‐type FBXL5, but this regulation was attenuated in the presence of ALKBH5 H204A mutation or FBLX5 synonymous mutation in potentially m 6 A sites.
Lentivirus Carrying The Cygb Cds (Protein Coding Region) Or Short Hairpin Rna (Shrna) Sequences (Ctcaacactgtcgtggagaacctgcatga), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/coding+region+sequence+cds/pmc11465429-36-9-41?v=Genechem
Average 90 stars, based on 1 article reviews
lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


A)ALKBH5 upregulated FBXL5 expression by m 6 A demethylation. We performed m 6 A sequencing in A549 cells and identified m 6 A peaks across different regions in negative control (EV) and ALKBH5 overexpressed (ALKBH5 OE) cells; B) Volcano plot displayed significant m 6 A methylation peaks that were upregulated and downregulated by ALKBH5; C) We observed decreased m 6 A methylation (m 6 A demethylation) in the genomic CDS region; D) Cumulative percent and E) quantified changes for methylation indicated overall decreased methylation by ALKBH5 overexpression; F) Specific decreased m 6 A peak of the CDS region in FBXL5 mRNA in the presence of ALKBH5 overexpression in A549 cells; G) IHC staining of NSCLC tissue microarray indicated a positive correlation between ALKBH5 and FBXL5 protein expression; H) Western blot revealed upregulated FBXL5 by ALKBH5 overexpression in A549 and H226 NSCLC cells; I) Graphical interpretation of FBXL5 and ALKBH5 mutations stably transfected into NSCLC cells; J) m 6 A‐RIP‐qPCR demonstrated m 6 A methylation in FBXL5 mRNA; K) Common RIP‐qPCR demonstrated binding of ALKBH5 to FBXL5 mRNA. Western blot was presented for quality control in protein extracted from the input group and the groups immunoprecipitated by IgG and ALKBH5 antibody; L) ALKBH5 H204A mutation impaired the binding of ALKBH5 to FBXL5 mRNA as indicated by RIP‐qPCR. Western blot was performed for quality control using protein extracted from the corresponding groups; M) Western blot in NSCLC cells indicated that wild‐type ALKBH5 could upregulate wild‐type FBXL5, but this regulation was attenuated in the presence of ALKBH5 H204A mutation or FBLX5 synonymous mutation in potentially m 6 A sites.

Journal: Advanced Science

Article Title: Cis‐Regulation of an m 6 A Eraser by an Insertion Variant Associated with Survival of Patients With Non‐Small Cell Lung Carcinoma

doi: 10.1002/advs.202407652

Figure Lengend Snippet: A)ALKBH5 upregulated FBXL5 expression by m 6 A demethylation. We performed m 6 A sequencing in A549 cells and identified m 6 A peaks across different regions in negative control (EV) and ALKBH5 overexpressed (ALKBH5 OE) cells; B) Volcano plot displayed significant m 6 A methylation peaks that were upregulated and downregulated by ALKBH5; C) We observed decreased m 6 A methylation (m 6 A demethylation) in the genomic CDS region; D) Cumulative percent and E) quantified changes for methylation indicated overall decreased methylation by ALKBH5 overexpression; F) Specific decreased m 6 A peak of the CDS region in FBXL5 mRNA in the presence of ALKBH5 overexpression in A549 cells; G) IHC staining of NSCLC tissue microarray indicated a positive correlation between ALKBH5 and FBXL5 protein expression; H) Western blot revealed upregulated FBXL5 by ALKBH5 overexpression in A549 and H226 NSCLC cells; I) Graphical interpretation of FBXL5 and ALKBH5 mutations stably transfected into NSCLC cells; J) m 6 A‐RIP‐qPCR demonstrated m 6 A methylation in FBXL5 mRNA; K) Common RIP‐qPCR demonstrated binding of ALKBH5 to FBXL5 mRNA. Western blot was presented for quality control in protein extracted from the input group and the groups immunoprecipitated by IgG and ALKBH5 antibody; L) ALKBH5 H204A mutation impaired the binding of ALKBH5 to FBXL5 mRNA as indicated by RIP‐qPCR. Western blot was performed for quality control using protein extracted from the corresponding groups; M) Western blot in NSCLC cells indicated that wild‐type ALKBH5 could upregulate wild‐type FBXL5, but this regulation was attenuated in the presence of ALKBH5 H204A mutation or FBLX5 synonymous mutation in potentially m 6 A sites.

Article Snippet: Western blot was used to detect whether the impact of ALKBH5 on FBXL5 was dependent on potential m 6 A sites in the FBXL5 coding sequence (CDS) region and ALKBH5 H204 protein region, with FLAG and HA antibody (Proteintech, China).

Techniques: Expressing, Sequencing, Negative Control, Methylation, Over Expression, Immunohistochemistry, Microarray, Western Blot, Stable Transfection, Transfection, Binding Assay, Control, Immunoprecipitation, Mutagenesis

A)ALKBH5‐FBXL5 axis decreased intracellular ROS and inhibited PI3K‐AKT and NF‐κB pathway activations to exert a cancer suppressor role in NSCLC. ALKBH5 overexpression and FBXL5 knockdown were performed in A549 cells and the opposite manipulation was performed in H226 cells, which was validated by western blot; B) ROS fluorescent probe staining and C) flow cytometric detection indicated decreased ROS levels by ALKBH5 overexpression, which was retrieved by FBXL5 knockdown in A549 cells, and opposite results were observed by in H226 cells with the corresponding manipulation; D) p‐AKT and p65, two key elements for PI3K and NF‐κB pathways activation, were downregulated by ALKBH5 overexpression, which could be reversed by FBXL5 downregulation in A549 cells. Conversely, PI3K and NF‐κB pathways could be activated by ALKBH5 downregulation, which was attenuated by FBXL5 upregulation in H226 cells; E,F) Colony formation and G,H) migration of A549 cells were inhibited by ALKBH5 overexpression but were retrieved by FBXL5 downregulation, and vice versa for the impact of ALKBH5‐FBXL5 axis on colony formation and migration in H226 cells I,J) Similarly, in vivo experiments demonstrated that FBXL5 was also indispensable for ALKBH5‐induced shrinkage of xenograft tumors constructed by A549 cells; K,L) IHC experiments of xenograft tumors for Ki‐67, PCNA, indicated less staining by ALKBH5 overexpression, which was partly restored in the presence of additional FBXL5 knockdown. HE was used as a background staining marker for NSCLC cells.

Journal: Advanced Science

Article Title: Cis‐Regulation of an m 6 A Eraser by an Insertion Variant Associated with Survival of Patients With Non‐Small Cell Lung Carcinoma

doi: 10.1002/advs.202407652

Figure Lengend Snippet: A)ALKBH5‐FBXL5 axis decreased intracellular ROS and inhibited PI3K‐AKT and NF‐κB pathway activations to exert a cancer suppressor role in NSCLC. ALKBH5 overexpression and FBXL5 knockdown were performed in A549 cells and the opposite manipulation was performed in H226 cells, which was validated by western blot; B) ROS fluorescent probe staining and C) flow cytometric detection indicated decreased ROS levels by ALKBH5 overexpression, which was retrieved by FBXL5 knockdown in A549 cells, and opposite results were observed by in H226 cells with the corresponding manipulation; D) p‐AKT and p65, two key elements for PI3K and NF‐κB pathways activation, were downregulated by ALKBH5 overexpression, which could be reversed by FBXL5 downregulation in A549 cells. Conversely, PI3K and NF‐κB pathways could be activated by ALKBH5 downregulation, which was attenuated by FBXL5 upregulation in H226 cells; E,F) Colony formation and G,H) migration of A549 cells were inhibited by ALKBH5 overexpression but were retrieved by FBXL5 downregulation, and vice versa for the impact of ALKBH5‐FBXL5 axis on colony formation and migration in H226 cells I,J) Similarly, in vivo experiments demonstrated that FBXL5 was also indispensable for ALKBH5‐induced shrinkage of xenograft tumors constructed by A549 cells; K,L) IHC experiments of xenograft tumors for Ki‐67, PCNA, indicated less staining by ALKBH5 overexpression, which was partly restored in the presence of additional FBXL5 knockdown. HE was used as a background staining marker for NSCLC cells.

Article Snippet: Western blot was used to detect whether the impact of ALKBH5 on FBXL5 was dependent on potential m 6 A sites in the FBXL5 coding sequence (CDS) region and ALKBH5 H204 protein region, with FLAG and HA antibody (Proteintech, China).

Techniques: Over Expression, Knockdown, Western Blot, Staining, Activation Assay, Migration, In Vivo, Construct, Marker